Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-290b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-290b-5p Accession Number: MIMAT0029900 Mature Sequence: GCUUAAAACUAGGCGGCACUUU mmu-miR-290b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-290b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-290b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Anti-Prostatic Acid Phosphatase Antibody, Rabbit Monoclonal
MBS8104428-01 0.1 mL

Recombinant Anti-Prostatic Acid Phosphatase Antibody, Rabbit Monoclonal

Sign In for Pricing
View Details
Recombinant Anti-Prostatic Acid Phosphatase Antibody, Rabbit Monoclonal
MBS8104428-02 5x 0.1 mL

Recombinant Anti-Prostatic Acid Phosphatase Antibody, Rabbit Monoclonal

Sign In for Pricing
View Details
Goat Anti-Human IgG (H&L) - AF350
BS21432-01 100 µL

Goat Anti-Human IgG (H&L) - AF350

Sign In for Pricing
View Details
Goat Anti-Human IgG (H&L) - AF350
BS21432-02 500 µL

Goat Anti-Human IgG (H&L) - AF350

Sign In for Pricing
View Details
RNF182 CRISPR All-in-one AAV vector set (with saCas9)(Rat)
40274156 3x 1.0 µg DNA

RNF182 CRISPR All-in-one AAV vector set (with saCas9)(Rat)

Sign In for Pricing
View Details
CPK32 Antibody
PHY8063A 150 μg

CPK32 Antibody

Sign In for Pricing
View Details