Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-221-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-221-5p Accession Number: MIMAT0017060 Mature Sequence: ACCUGGCAUACAAUGUAGAUUUCUGU mmu-miR-221-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-221-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-221-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Neurturin Biotinylated Affinity Purified PAb
BAF387 50 µg

Human Neurturin Biotinylated Affinity Purified PAb

Sign In for Pricing
View Details
Recombinant HCV NS5 Antigen, GST-tagged, Biotin-Labled
HCV-227 1 Vial

Recombinant HCV NS5 Antigen, GST-tagged, Biotin-Labled

Sign In for Pricing
View Details
Valemetostat
558285 5.0mg

Valemetostat

Sign In for Pricing
View Details
CDR2 Human qPCR Primer Pair (NM_001802)
HP205589 200 Reactions

CDR2 Human qPCR Primer Pair (NM_001802)

Sign In for Pricing
View Details
Pig Acyl-CoA desaturase (SCD) ELISA Kit
RK15013 96 Tests

Pig Acyl-CoA desaturase (SCD) ELISA Kit

Sign In for Pricing
View Details
PROX1 (prospero Homeobox 1) (MaxLight 490)
MBS6208084-01 0.1 mL

PROX1 (prospero Homeobox 1) (MaxLight 490)

Sign In for Pricing
View Details