Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5123 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5123 Accession Number: MIMAT0020633 Mature Sequence: UGUAGAUCCAUAUGCCAUGGUGUG mmu-miR-5123 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5123 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5123 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Iigp1 (NM_001146275) Mouse Tagged ORF Clone Lentiviral Particle
MR206520L4V 200 µL

Iigp1 (NM_001146275) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
C8orf54 CRISPR Knock Out 293T Cell Line (Human)
53870141 1x 10^6 Cells / 1.0 mL

C8orf54 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
PRF1 Protein Vector (Rat) (pPB-C-His)
PV295990 500 ng

PRF1 Protein Vector (Rat) (pPB-C-His)

Sign In for Pricing
View Details
HDAC5, ID (Histone Deacetylase 5, HD5, Antigen NY-CO-9, KIAA0600) (AP) discontinued
H1827-65F-AP 200 µL

HDAC5, ID (Histone Deacetylase 5, HD5, Antigen NY-CO-9, KIAA0600) (AP) discontinued

Sign In for Pricing
View Details
APOA4 Protein Vector (Human) (pPM-C-His)
PV048900 500 ng

APOA4 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details
CJ131 rabbit pAb
ES19402-01 50 µL

CJ131 rabbit pAb

Sign In for Pricing
View Details