Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5123 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5123 Accession Number: MIMAT0020633 Mature Sequence: UGUAGAUCCAUAUGCCAUGGUGUG mmu-miR-5123 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5123 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5123 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RAB27B, CT (RAB27B, Ras-related protein Rab-27B, C25KG) (AP)
MBS6339668-01 0.2 mL

RAB27B, CT (RAB27B, Ras-related protein Rab-27B, C25KG) (AP)

Sign In for Pricing
View Details
RAB27B, CT (RAB27B, Ras-related protein Rab-27B, C25KG) (AP)
MBS6339668-02 5x 0.2 mL

RAB27B, CT (RAB27B, Ras-related protein Rab-27B, C25KG) (AP)

Sign In for Pricing
View Details
Cyclophilin F (PPIF) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI7D12]
TA809030AM 100 µL

Cyclophilin F (PPIF) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI7D12]

Sign In for Pricing
View Details
VCX3B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
49453111 3x 1.0 µg

VCX3B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Sheep PBP ELISA Kit
ESP0623 96 Tests

Sheep PBP ELISA Kit

Sign In for Pricing
View Details
Cortisol-BSA
E62G01402 100 µg

Cortisol-BSA

Sign In for Pricing
View Details