Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5121 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5121 Accession Number: MIMAT0020629 Mature Sequence: AGCUUGUGAUGAGACAUCUCC mmu-miR-5121 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5121 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5121 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Tmem163 (NM_028135) AAV Particle
MR203920A1V 250 µL

Mouse Tmem163 (NM_028135) AAV Particle

Sign In for Pricing
View Details
FOXO3 Human shRNA Plasmid Kit (Locus ID 2309)
TR320359 1 Kit

FOXO3 Human shRNA Plasmid Kit (Locus ID 2309)

Sign In for Pricing
View Details
Apol7e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
12198114 3x 1.0 µg

Apol7e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
CLDN15 Antibody
64-137 400 µL

CLDN15 Antibody

Sign In for Pricing
View Details
Anti-Caveolin 2 Antibody
MBS9240476-01 0.05 mL

Anti-Caveolin 2 Antibody

Sign In for Pricing
View Details
Anti-Caveolin 2 Antibody
MBS9240476-02 0.1 mL

Anti-Caveolin 2 Antibody

Sign In for Pricing
View Details