Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6541 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6541 Accession Number: MIMAT0025588 Mature Sequence: CACAGGCAAGGACUUCUCAAG mmu-miR-6541 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6541 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6541 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

HLTF discontinued
390000 200 µL

HLTF discontinued

Sign In for Pricing
View Details
CHMP2A (NM_014453) Human Tagged Lenti ORF Clone
RC200068L1 10 µg

CHMP2A (NM_014453) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
TMEM184B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
46959066 1.0 µg DNA

TMEM184B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
Culture Medium for African Green Monkey Kidney Cell (Sv40 Transformed) [COS-7]
AFG-ELL-1303-01 125 mL

Culture Medium for African Green Monkey Kidney Cell (Sv40 Transformed) [COS-7]

Sign In for Pricing
View Details
Culture Medium for African Green Monkey Kidney Cell (Sv40 Transformed) [COS-7]
AFG-ELL-1303-02 500 mL

Culture Medium for African Green Monkey Kidney Cell (Sv40 Transformed) [COS-7]

Sign In for Pricing
View Details
PBiT2.1-N TK-SmBiT-Nr4a2 Plasmid
PVT74297 2 µg

PBiT2.1-N TK-SmBiT-Nr4a2 Plasmid

Sign In for Pricing
View Details