Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6541 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6541 Accession Number: MIMAT0025588 Mature Sequence: CACAGGCAAGGACUUCUCAAG mmu-miR-6541 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6541 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6541 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MEGF10 (NM_032446) Human Over-expression Lysate
LY410139 100 µg

MEGF10 (NM_032446) Human Over-expression Lysate

Sign In for Pricing
View Details
Gm136 (NM_001033255) Mouse Tagged Lenti ORF Clone
MR214286L3 10 µg

Gm136 (NM_001033255) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Lentiviral mouse Hoxd12 shRNA (UAS) - Lentiviral mouse Hoxd12 shRNA (UAS, GFP) (100)
GTR15219657 1 Vial

Lentiviral mouse Hoxd12 shRNA (UAS) - Lentiviral mouse Hoxd12 shRNA (UAS, GFP) (100)

Sign In for Pricing
View Details
Cxcl10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7388508 1.0 µg DNA

Cxcl10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
2-Bromopyridine
1021830 100 100 g

2-Bromopyridine

Sign In for Pricing
View Details
Lentiviral human OLIG2 shRNA (UAS) - Lentiviral human OLIG2 shRNA (UAS, iRFP) plasmid
GTR15099928 1 Vial

Lentiviral human OLIG2 shRNA (UAS) - Lentiviral human OLIG2 shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details