Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5113 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5113 Accession Number: MIMAT0020621 Mature Sequence: ACAGAGGAGGAGAGAGAUCCUGU mmu-miR-5113 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5113 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5113 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

C16orf75 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0313405 3x 1.0 µg

C16orf75 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Tmem110 Rabbit Polyclonal Antibody
TA333344 100 µL

Tmem110 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Olr471 3'UTR GFP Stable Cell Line
TU265236 1.0 mL

Olr471 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Recombinant Arabidopsis thaliana Surfeit locus protein 1 (SURF1), partial
MBS7099468 Inquire

Recombinant Arabidopsis thaliana Surfeit locus protein 1 (SURF1), partial

Sign In for Pricing
View Details
XCL1 (Lymphotactin, ATAC, C Motif Chemokine 1, Cytokine SCM-1, Lymphotaxin, SCM-1-alpha, Small-inducible Cytokine C1, XC Chemokine Ligand 1, LTN, SCYC1) (APC)
135437-APC 100 µL

XCL1 (Lymphotactin, ATAC, C Motif Chemokine 1, Cytokine SCM-1, Lymphotaxin, SCM-1-alpha, Small-inducible Cytokine C1, XC Chemokine Ligand 1, LTN, SCYC1) (APC)

Sign In for Pricing
View Details
Cycs Mouse siRNA Oligo Duplex (Locus ID 13063)
SR401266 1 Kit

Cycs Mouse siRNA Oligo Duplex (Locus ID 13063)

Sign In for Pricing
View Details