Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1983 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1983 Accession Number: MIMAT0009455 Mature Sequence: CUCACCUGGAGCAUGUUUUCU mmu-miR-1983 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1983 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1983 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Research Grade Anti-ZEBOV GP/Glycoprotein (Zmapp)
DVV03609 100 μg

Research Grade Anti-ZEBOV GP/Glycoprotein (Zmapp)

Sign In for Pricing
View Details
Recombinant Klebsiella Pneumoniae rplC Protein (aa 1-209) (strain ATCC 700721 / MGH 78578)
VAng-Cr5324-500gEcoli 500 µg (E. coli)

Recombinant Klebsiella Pneumoniae rplC Protein (aa 1-209) (strain ATCC 700721 / MGH 78578)

Sign In for Pricing
View Details
Cepharanthine
GP8908-50mg 50 mg

Cepharanthine

Sign In for Pricing
View Details
ASMTL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV707586 1.0 µg DNA

ASMTL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

Sign In for Pricing
View Details
Semenogelin II (SEMG2) (NM_003008) Human Over-expression Lysate
LS006407-20ug 20 µg

Semenogelin II (SEMG2) (NM_003008) Human Over-expression Lysate

Sign In for Pricing
View Details
Nori® Rabbit PLA2G4A ELISA Kit
GR144076 96 Well

Nori® Rabbit PLA2G4A ELISA Kit

Sign In for Pricing
View Details