Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6539 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6539 Accession Number: MIMAT0025584 Mature Sequence: GCACAGUGAUGAACUCUGAGGGCU mmu-miR-6539 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6539 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6539 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal SGEF Antibody [PE]
NBP3-05912PE 0.1 mL

Rabbit Polyclonal SGEF Antibody [PE]

Sign In for Pricing
View Details
Human MT1F shRNA Plasmid
abx952984-01 150 µg

Human MT1F shRNA Plasmid

Sign In for Pricing
View Details
Human MT1F shRNA Plasmid
abx952984-02 300 µg

Human MT1F shRNA Plasmid

Sign In for Pricing
View Details
MGC72080 Protein Vector (Human) (pPB-C-His)
PV025865 500 ng

MGC72080 Protein Vector (Human) (pPB-C-His)

Sign In for Pricing
View Details
Fcgr1 (NM_010186) Mouse Tagged Lenti ORF Clone
MR225268L2 10 µg

Fcgr1 (NM_010186) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
ZHX2 Polyclonal Antibody, AbBy Fluor™ 350 Conjugated
bs-7581R-BF350 100 µL

ZHX2 Polyclonal Antibody, AbBy Fluor™ 350 Conjugated

Sign In for Pricing
View Details