Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5110 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5110 Accession Number: MIMAT0020618 Mature Sequence: GGAGGAGGUAGAGGGUGGUGGAAUU mmu-miR-5110 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5110 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5110 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MYOD1 Mouse Monoclonal Antibody [Clone ID: 1C8]
AM06516SU-N 100 µL

MYOD1 Mouse Monoclonal Antibody [Clone ID: 1C8]

Sign In for Pricing
View Details
Epicatechin
600131 1.0g

Epicatechin

Sign In for Pricing
View Details
C1D shRNA (m) Lentiviral Particles
sc-141839-V 200 µL

C1D shRNA (m) Lentiviral Particles

Sign In for Pricing
View Details
VHLL Antibody, FITC conjugated
A59054-50UG 50 µg

VHLL Antibody, FITC conjugated

Sign In for Pricing
View Details
SB290157 trifluoroacetate 5mg
A21347-5 5 mg

SB290157 trifluoroacetate 5mg

Sign In for Pricing
View Details
PF-06305591 dihydrate
MF-0139307 100 mg

PF-06305591 dihydrate

Sign In for Pricing
View Details