Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1969 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1969 Accession Number: MIMAT0009442 Mature Sequence: AAGAUGGAGACUUUAACAUGGGU mmu-miR-1969 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1969 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1969 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Elab Fluor® 488 Mouse IgG2b, κ Isotype Control[MPC-11]
E-AB-F09813L-01 25 µg

Elab Fluor® 488 Mouse IgG2b, κ Isotype Control[MPC-11]

Sign In for Pricing
View Details
Elab Fluor® 488 Mouse IgG2b, κ Isotype Control[MPC-11]
E-AB-F09813L-02 100 µg

Elab Fluor® 488 Mouse IgG2b, κ Isotype Control[MPC-11]

Sign In for Pricing
View Details
3-Acetylacetanilide
TRC-A133000-250MG 250 mg

3-Acetylacetanilide

Sign In for Pricing
View Details
QuantiChrom™ Detergent Assay Kit.
DDTR-100 100 Tests

QuantiChrom™ Detergent Assay Kit.

Sign In for Pricing
View Details
AK6 (NM_016283) Human Over-expression Lysate
LC402534 20 µg

AK6 (NM_016283) Human Over-expression Lysate

Sign In for Pricing
View Details
HSP10 Antibody
8C0230-AAT 50 µg

HSP10 Antibody

Sign In for Pricing
View Details