Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3473c miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3473c Accession Number: MIMAT0020614 Mature Sequence: UCUCUCCAGCCCCCAUAAUAAG mmu-miR-3473c are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3473c in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3473c miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

ABflo® 500 Rabbit anti-Human CD138 mAb
A27394-01 50 Tests

ABflo® 500 Rabbit anti-Human CD138 mAb

Ask
View Details
ABflo® 500 Rabbit anti-Human CD138 mAb
A27394-02 100 Tests

ABflo® 500 Rabbit anti-Human CD138 mAb

Ask
View Details
ABflo® 500 Rabbit anti-Human CD138 mAb
A27394-03 200 Tests

ABflo® 500 Rabbit anti-Human CD138 mAb

Ask
View Details
ABflo® 500 Rabbit anti-Human CD138 mAb
A27394-04 500 Tests

ABflo® 500 Rabbit anti-Human CD138 mAb

Ask
View Details
Rabbit Polyclonal SYPL1 Antibody [Alexa Fluor 350]
NBP1-76316AF350 0.1 mL

Rabbit Polyclonal SYPL1 Antibody [Alexa Fluor 350]

Ask
View Details
Mouse Monoclonal DDX3 Antibody (11F11D10) [Alexa Fluor 532]
NBP2-14848AF532 0.1 mL

Mouse Monoclonal DDX3 Antibody (11F11D10) [Alexa Fluor 532]

Ask
View Details