Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5101 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5101 Accession Number: MIMAT0020608 Mature Sequence: UUUGUUUGUUUUGCUGAUGCAG mmu-miR-5101 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5101 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5101 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD44v4 (Marker of Tumor Metastasis), CF405S conjugate, 0.1mg/mL
BNC041751-500 1x 500 µL

CD44v4 (Marker of Tumor Metastasis), CF405S conjugate, 0.1mg/mL

Sign In for Pricing
View Details
SLC9A9 Rabbit Polyclonal Antibody
TA371524 100 µL

SLC9A9 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Smad Interacting Protein 1 (ZEB2) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI4G3]
TA802114AM 100 µL

Smad Interacting Protein 1 (ZEB2) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI4G3]

Sign In for Pricing
View Details
5-CARBOXYTetramethylrhodamine, SE (5-TAM
#90034 1x 5 mg

5-CARBOXYTetramethylrhodamine, SE (5-TAM

Sign In for Pricing
View Details
UGT3A1 (NM_152404) Human Recombinant Protein
TP309702 20 µg

UGT3A1 (NM_152404) Human Recombinant Protein

Sign In for Pricing
View Details
Nectin-4 Recombinant Rabbit monoclonal Antibody
HA723138 100 µL

Nectin-4 Recombinant Rabbit monoclonal Antibody

Sign In for Pricing
View Details