Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-100-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-100-3p Accession Number: MIMAT0017051 Mature Sequence: ACAAGCUUGUGUCUAUAGGUAU mmu-miR-100-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-100-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-100-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RPS3P3 AAV siRNA Pooled Vector
42549161 1.0 µg

RPS3P3 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
Mouse Monoclonal SOX10 Antibody (SOX10/991) [Alexa Fluor 350]
NBP2-59621AF350 0.1 mL

Mouse Monoclonal SOX10 Antibody (SOX10/991) [Alexa Fluor 350]

Sign In for Pricing
View Details
LOC500077 (NM_001024325) Rat Tagged ORF Clone Lentiviral Particle
RR205551L3V 200 µL

LOC500077 (NM_001024325) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
All 4 CD-ROM to School Sets A no. 500, B no. 600, C no. 700 and D no. 750 together, with Photomicrographs, diagrams and teaching material. Containing 1481 pictures and text
CD085 15 x 13 x 1 cm

All 4 CD-ROM to School Sets A no. 500, B no. 600, C no. 700 and D no. 750 together, with Photomicrographs, diagrams and teaching material. Containing 1481 pictures and text

Sign In for Pricing
View Details
Osteopontin Antibody
MBS853169-01 0.1 mg

Osteopontin Antibody

Sign In for Pricing
View Details
Osteopontin Antibody
MBS853169-02 0.1 mL (AF635)

Osteopontin Antibody

Sign In for Pricing
View Details