Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-873b miRNA Agomir/Antagomir

MicroRNA: mmu-miR-873b Accession Number: MIMAT0025177 Mature Sequence: ACAAGUUCCUGCAAAUGCACAC mmu-miR-873b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-873b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-873b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human CAPS shRNA Plasmid
abx950582-01 150 µg

Human CAPS shRNA Plasmid

Sign In for Pricing
View Details
Human CAPS shRNA Plasmid
abx950582-02 300 µg

Human CAPS shRNA Plasmid

Sign In for Pricing
View Details
Human C-Reactive Protein (Recombinant)
22060288-1 500 µg

Human C-Reactive Protein (Recombinant)

Sign In for Pricing
View Details
Rabbit Polyclonal TMLHE Antibody
NBP1-32144 0.1 mL

Rabbit Polyclonal TMLHE Antibody

Sign In for Pricing
View Details
FLK1 (Vascular Endothelial Growth Factor Receptor 2, VEGFR-2, Fetal Liver Kinase 1, FLK-1, Kinase NYK, Protein-tyrosine Kinase Receptor flk-1, CD309, Kdr, Flk-1, Flk1)
F4565-08A 100 µL

FLK1 (Vascular Endothelial Growth Factor Receptor 2, VEGFR-2, Fetal Liver Kinase 1, FLK-1, Kinase NYK, Protein-tyrosine Kinase Receptor flk-1, CD309, Kdr, Flk-1, Flk1)

Sign In for Pricing
View Details
Myo5c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3228007 1.0 µg DNA

Myo5c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details