Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-7074-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7074-5p Accession Number: MIMAT0028054 Mature Sequence: UGGGAAGAGGCUAGGGCUCCAGU mmu-miR-7074-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-7074-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-7074-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RFWD3 Human Gene Knockout Kit (CRISPR)
KN409196 1 Kit

RFWD3 Human Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Anti-Hendra virus/HeV Glycoprotein G Monoclonal Antibody (1A733)
VK685055-01 50 µg

Anti-Hendra virus/HeV Glycoprotein G Monoclonal Antibody (1A733)

Sign In for Pricing
View Details
Anti-Hendra virus/HeV Glycoprotein G Monoclonal Antibody (1A733)
VK685055-02 100 µg

Anti-Hendra virus/HeV Glycoprotein G Monoclonal Antibody (1A733)

Sign In for Pricing
View Details
PRR19 Protein Vector (Rat) (pPM-C-His)
PV296513 500 ng

PRR19 Protein Vector (Rat) (pPM-C-His)

Sign In for Pricing
View Details
KLF17, CT (KLF17, ZNF393, Krueppel-like factor 17, Zinc finger protein 393) (Biotin) discontinued
037525-Biotin 200 µL

KLF17, CT (KLF17, ZNF393, Krueppel-like factor 17, Zinc finger protein 393) (Biotin) discontinued

Sign In for Pricing
View Details
VPS36 3'UTR Luciferase Stable Cell Line
TU028295 1.0 mL

VPS36 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details