Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5098 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5098 Accession Number: MIMAT0020605 Mature Sequence: GUUACAUGGUGAAGCCCAGUU mmu-miR-5098 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5098 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5098 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal HIF-1 alpha Antibody [CoraFluor 1]
NBP1-47179CL1 0.1 mL

Rabbit Polyclonal HIF-1 alpha Antibody [CoraFluor 1]

Sign In for Pricing
View Details
Mouse Anti-Pig IgG (H&L) HRP
E51S2116 100 µL

Mouse Anti-Pig IgG (H&L) HRP

Sign In for Pricing
View Details
Sphk1 (NM_001172473) Mouse Tagged Lenti ORF Clone
MR226232L4 10 µg

Sphk1 (NM_001172473) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
ZDHHC17 (Zinc Finger CCHC Domain Containing 17, HIP3, HYPH, HIP14, HSPC294) (Biotin)
MBS6443757-01 0.1 mL

ZDHHC17 (Zinc Finger CCHC Domain Containing 17, HIP3, HYPH, HIP14, HSPC294) (Biotin)

Sign In for Pricing
View Details
ZDHHC17 (Zinc Finger CCHC Domain Containing 17, HIP3, HYPH, HIP14, HSPC294) (Biotin)
MBS6443757-02 5x 0.1 mL

ZDHHC17 (Zinc Finger CCHC Domain Containing 17, HIP3, HYPH, HIP14, HSPC294) (Biotin)

Sign In for Pricing
View Details
UBA52P8 ORF Vector (Human) (pORF)
ORF035375 1.0 µg DNA

UBA52P8 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details