Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-28a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-28a-3p Accession Number: MIMAT0004661 Mature Sequence: CACUAGAUUGUGAGCUGCUGGA mmu-miR-28a-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-28a-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-28a-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Futibatinib (TAS-120)
206535 5.0mg

Futibatinib (TAS-120)

Sign In for Pricing
View Details
CELF4 (BRUNOL4, CUGBP Elav-like Family Member 4, CELF-4, Bruno-like Protein 4, CUG-BP- and ETR-3-like Factor 4, RNA-binding Protein BRUNOL-4) (Biotin)
124016-Biotin 100 µL

CELF4 (BRUNOL4, CUGBP Elav-like Family Member 4, CELF-4, Bruno-like Protein 4, CUG-BP- and ETR-3-like Factor 4, RNA-binding Protein BRUNOL-4) (Biotin)

Sign In for Pricing
View Details
pOTB7-NDN Plasmid
PVT24270 2 µg

pOTB7-NDN Plasmid

Sign In for Pricing
View Details
MPP7 Protein Vector (Mouse) (pPB-C-His)
PV201730 500 ng

MPP7 Protein Vector (Mouse) (pPB-C-His)

Sign In for Pricing
View Details
Lentiviral human TLR7 shRNA (UAS) - Lentiviral human TLR7 shRNA (UAS, iRFP) plasmid
GTR15088516 1 Vial

Lentiviral human TLR7 shRNA (UAS) - Lentiviral human TLR7 shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details
SLC25A32 sgRNA CRISPR Lentivector set (Human)
K2179501 3x 1.0 µg

SLC25A32 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details