Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3971 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3971 Accession Number: MIMAT0019356 Mature Sequence: CUCCCCACCCCUGUACCAGUGA mmu-miR-3971 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3971 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3971 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Quick-DNA/RNA FFPE Kit (50 Preps)
R1009 50 Preparations

Quick-DNA/RNA FFPE Kit (50 Preps)

Sign In for Pricing
View Details
PH 0.5-5 Test Strips
GR238012 Pack of 100

PH 0.5-5 Test Strips

Sign In for Pricing
View Details
Arg 3.1 (ARC) Mouse Monoclonal Antibody [Clone ID: LBI2B3]
AMM20578VCF 100 µg

Arg 3.1 (ARC) Mouse Monoclonal Antibody [Clone ID: LBI2B3]

Sign In for Pricing
View Details
SLC6A19 Adenovirus (Mouse)
44256054 1.0 mL

SLC6A19 Adenovirus (Mouse)

Sign In for Pricing
View Details
Mouse Serine/Threonine Kinase 3 (STK3) Protein
abx168384-01 10 µg

Mouse Serine/Threonine Kinase 3 (STK3) Protein

Sign In for Pricing
View Details
Mouse Serine/Threonine Kinase 3 (STK3) Protein
abx168384-02 50 µg

Mouse Serine/Threonine Kinase 3 (STK3) Protein

Sign In for Pricing
View Details