Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1958 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1958 Accession Number: MIMAT0009431 Mature Sequence: UAGGAAAGUGGAAGCAGUAAGU mmu-miR-1958 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1958 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1958 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

SIGLECP10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2149402 1.0 µg DNA

SIGLECP10 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Vmn2r28 Mouse shRNA Lentiviral Particle (Locus ID 665255)
TL518136V 500 µL Each

Vmn2r28 Mouse shRNA Lentiviral Particle (Locus ID 665255)

Sign In for Pricing
View Details
TTDN1 (MPLKIP) Human shRNA Plasmid Kit (Locus ID 136647)
TF317871 1 Kit

TTDN1 (MPLKIP) Human shRNA Plasmid Kit (Locus ID 136647)

Sign In for Pricing
View Details
RNF103 (RING Finger Protein 103, KF1, MGC102815, MGC41857, ZFP103, hkf-1) (AP)
MBS6164849-01 0.1 mL

RNF103 (RING Finger Protein 103, KF1, MGC102815, MGC41857, ZFP103, hkf-1) (AP)

Sign In for Pricing
View Details
RNF103 (RING Finger Protein 103, KF1, MGC102815, MGC41857, ZFP103, hkf-1) (AP)
MBS6164849-02 5x 0.1 mL

RNF103 (RING Finger Protein 103, KF1, MGC102815, MGC41857, ZFP103, hkf-1) (AP)

Sign In for Pricing
View Details
TRIM68 ORF Vector (Human) (pORF)
ORF034530 1.0 µg DNA

TRIM68 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details