Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1958 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1958 Accession Number: MIMAT0009431 Mature Sequence: UAGGAAAGUGGAAGCAGUAAGU mmu-miR-1958 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1958 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1958 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ATP5LP6 3'UTR Luciferase Stable Cell Line
TU001436 1.0 mL

ATP5LP6 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
DKKL2 CRISPR All-in-one AAV vector set (with saCas9)(Human)
56557151 3x 1.0 µg DNA

DKKL2 CRISPR All-in-one AAV vector set (with saCas9)(Human)

Sign In for Pricing
View Details
NCRNA00158 3'UTR Luciferase Stable Cell Line
TU015360 1.0 mL

NCRNA00158 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
Olfr393 Mouse shRNA Lentiviral Particle (Locus ID 259010)
TL516417V 500 µL Each

Olfr393 Mouse shRNA Lentiviral Particle (Locus ID 259010)

Sign In for Pricing
View Details
Centrin 2 Overexpression Lysate (Native) - (Dry Ice)
NBL1-09116 0.1 mg

Centrin 2 Overexpression Lysate (Native) - (Dry Ice)

Sign In for Pricing
View Details
IRS-4 Rabbit pAb
E47R23362 100 µL

IRS-4 Rabbit pAb

Sign In for Pricing
View Details