Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6417 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6417 Accession Number: MIMAT0025172 Mature Sequence: UAGCAAACGACAGCUAGCCACA mmu-miR-6417 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6417 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6417 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GZMA Peptide
DF9054-BP 1 mg

GZMA Peptide

Sign In for Pricing
View Details
Recombinant Human IGLON5 Protein
E30PQ693 20 µg

Recombinant Human IGLON5 Protein

Sign In for Pricing
View Details
MEMO1 (1-297aa) Monoclonal Antibody
E53M01522 100 µL

MEMO1 (1-297aa) Monoclonal Antibody

Sign In for Pricing
View Details
CCDC102B Antibody
A12039-50UG 50 µg

CCDC102B Antibody

Sign In for Pricing
View Details
Entpd4 (NM_001108384) Rat Tagged ORF Clone Lentiviral Particle
RR209141L4V 200 µL

Entpd4 (NM_001108384) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
USP22 Protein Vector (Rat) (pPB-C-His)
PV314758 500 ng

USP22 Protein Vector (Rat) (pPB-C-His)

Sign In for Pricing
View Details