Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1956 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1956 Accession Number: MIMAT0009428 Mature Sequence: AGUCCAGGGCUGAGUCAGCGGA mmu-miR-1956 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1956 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1956 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

[Hydroxy(tosyloxy)iodo]benzene
TRC-H962153-500MG 500 mg

[Hydroxy(tosyloxy)iodo]benzene

Sign In for Pricing
View Details
Ebi3 Rat Monoclonal Antibody [Clone ID: DNT27]
AM31375PU-N 50 µg

Ebi3 Rat Monoclonal Antibody [Clone ID: DNT27]

Sign In for Pricing
View Details
ATP-GloTM Bioluminometric Cell Viability Assay Kit (50 assays)
#30020-T 1 Kit

ATP-GloTM Bioluminometric Cell Viability Assay Kit (50 assays)

Sign In for Pricing
View Details
IL32 (NM_001012718) Human Over-expression Lysate
LY422819 100 µg

IL32 (NM_001012718) Human Over-expression Lysate

Sign In for Pricing
View Details
Calcipressin 1 (RCAN1) Mouse Monoclonal Antibody [Clone ID: OTI10C6]
CF810470 100 µg

Calcipressin 1 (RCAN1) Mouse Monoclonal Antibody [Clone ID: OTI10C6]

Sign In for Pricing
View Details
Butyl 4-Aminobenzoate(Butamben)
TRC-B689905-25G 25 g

Butyl 4-Aminobenzoate(Butamben)

Sign In for Pricing
View Details