Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6414 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6414 Accession Number: MIMAT0025168 Mature Sequence: CUAAGUUCUGAGCUGAGUCUUG mmu-miR-6414 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6414 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6414 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

DENND2B (NM_005418) Human Over-expression Lysate
LS006764-20ug 20 µg

DENND2B (NM_005418) Human Over-expression Lysate

Sign In for Pricing
View Details
CXorf57 Protein Vector (Human) (pPB-N-His)
PV011342 500 ng

CXorf57 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Carnitine O-Octanoyltransferase (CROT) Antibody
abx213949-01 50 µL

Carnitine O-Octanoyltransferase (CROT) Antibody

Sign In for Pricing
View Details
Carnitine O-Octanoyltransferase (CROT) Antibody
abx213949-02 100 µL

Carnitine O-Octanoyltransferase (CROT) Antibody

Sign In for Pricing
View Details
ASCL4 Rabbit Polyclonal Antibody
BT-AP06083-01 20 µL

ASCL4 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
ASCL4 Rabbit Polyclonal Antibody
BT-AP06083-02 50 µL

ASCL4 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details