Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1954 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1954 Accession Number: MIMAT0009425 Mature Sequence: ACUGCAGAGUGAGACCCUGUU mmu-miR-1954 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1954 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1954 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

C21orf110 sgRNA CRISPR Lentivector (Human) (Target 2)
K0343303 1.0 µg DNA

C21orf110 sgRNA CRISPR Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
Human Ubiquitin Cross Reactive Protein (UCRP) ELISA Kit
RD-UCRP-Hu-96Tests 96 Tests

Human Ubiquitin Cross Reactive Protein (UCRP) ELISA Kit

Sign In for Pricing
View Details
Mouse Monoclonal LAG-3 Antibody (874528) [Janelia Fluor 525]
FAB23197JF525 0.1 mL

Mouse Monoclonal LAG-3 Antibody (874528) [Janelia Fluor 525]

Sign In for Pricing
View Details
T-box Brain Protein 1 (TBR1, T-box Brain 1, T-brain-1) (MaxLight 405) discontinued
T1848-23-ML405 100 µL

T-box Brain Protein 1 (TBR1, T-box Brain 1, T-brain-1) (MaxLight 405) discontinued

Sign In for Pricing
View Details
PWP1 Recombinant Antibody, FITC Conjugated
bsm-62747R-FITC 100 µL

PWP1 Recombinant Antibody, FITC Conjugated

Sign In for Pricing
View Details
TTC32 antibody
MBS833547-01 0.1 mL

TTC32 antibody

Sign In for Pricing
View Details