Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-378b miRNA Agomir/Antagomir

MicroRNA: mmu-miR-378b Accession Number: MIMAT0019348 Mature Sequence: CUGGACUUGGAGUCAGAAGA mmu-miR-378b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-378b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-378b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

FITC Conjugated Goat Affinity Purified Antibody to Cat IgG Antibody
FAF-421-1 1 mL

FITC Conjugated Goat Affinity Purified Antibody to Cat IgG Antibody

Sign In for Pricing
View Details
Carboxypeptidase A2 (CPA2) Antibody
3816-100 100 µg

Carboxypeptidase A2 (CPA2) Antibody

Sign In for Pricing
View Details
TMEM177 CRISPR Activation Plasmid (h)
sc-413400-ACT 20 µg

TMEM177 CRISPR Activation Plasmid (h)

Sign In for Pricing
View Details
Noggin, Human, Purified Recombinant Protein
PE-1245-5 5 µg

Noggin, Human, Purified Recombinant Protein

Sign In for Pricing
View Details
CDH9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV651704 1.0 µg DNA

CDH9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

Sign In for Pricing
View Details
AKR1C1 (Aldo-keto Reductase Family 1 Member C1, 20-alpha-hydroxysteroid Dehydrogenase, 20-alpha-HSD, Chlordecone Reductase Homolog HAKRC, Dihydrodiol Dehydrogenase 1/2, DD1/DD2, High-affinity Hepatic Bile Acid-binding Protein, HBAB, Indanol Dehydrogenase, Trans-1,2-dihydrobenzene-1,2-diol Dehydrogenase, DDH, DDH1)
123158 100 µg

AKR1C1 (Aldo-keto Reductase Family 1 Member C1, 20-alpha-hydroxysteroid Dehydrogenase, 20-alpha-HSD, Chlordecone Reductase Homolog HAKRC, Dihydrodiol Dehydrogenase 1/2, DD1/DD2, High-affinity Hepatic Bile Acid-binding Protein, HBAB, Indanol Dehydrogenase, Trans-1,2-dihydrobenzene-1,2-diol Dehydrogenase, DDH, DDH1)

Sign In for Pricing
View Details