Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6409 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6409 Accession Number: MIMAT0025162 Mature Sequence: UGCGGGUGAGGAUGUGUGCUCCU mmu-miR-6409 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6409 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6409 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Phospho-NFKB p65 (Ser536) (Clone: B7) rabbit mAb
12-4307-20 20 µL

Phospho-NFKB p65 (Ser536) (Clone: B7) rabbit mAb

Sign In for Pricing
View Details
Human EDRF1 knockout cell line
ABC-KH4596 1 Vial

Human EDRF1 knockout cell line

Sign In for Pricing
View Details
Rabbit Polyclonal CCT5 Antibody
NBP1-83042-25ul 25 µL

Rabbit Polyclonal CCT5 Antibody

Sign In for Pricing
View Details
BRD7 Protein Vector (Human) (pPM-C-HA)
PV004247 500 ng

BRD7 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
DISC1 (NM_001164555) Human 3' UTR Clone
SC208704 10 µg

DISC1 (NM_001164555) Human 3' UTR Clone

Sign In for Pricing
View Details
Anti-GLUT5 / SLC2A5 antibody
STJ71961 100 µg

Anti-GLUT5 / SLC2A5 antibody

Sign In for Pricing
View Details