Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-20b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-20b-5p Accession Number: MIMAT0003187 Mature Sequence: CAAAGUGCUCAUAGUGCAGGUAG mmu-miR-20b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-20b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-20b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

DDX39 Antibody
GWB-85AE74 0.1 mg

DDX39 Antibody

Sign In for Pricing
View Details
Pig Cys-C ELISA Kit
E108112 1 Each

Pig Cys-C ELISA Kit

Sign In for Pricing
View Details
ROCK1 Antibody
A33463-100UL 100 µL

ROCK1 Antibody

Sign In for Pricing
View Details
PSMD6 (26S Proteasome Non-ATPase Regulatory Subunit 6, 26S Proteasome Regulatory Subunit RPN7, 26S Proteasome Regulatory Subunit S10, Breast Cancer-associated Protein SGA-113M, Phosphonoformate Immuno-associated Protein 4, Proteasome Regulatory Particle Subunit p44S10, p42A, KIAA0107, PFAAP4) (MaxLight 550)
131982-ML550 100 µL

PSMD6 (26S Proteasome Non-ATPase Regulatory Subunit 6, 26S Proteasome Regulatory Subunit RPN7, 26S Proteasome Regulatory Subunit S10, Breast Cancer-associated Protein SGA-113M, Phosphonoformate Immuno-associated Protein 4, Proteasome Regulatory Particle Subunit p44S10, p42A, KIAA0107, PFAAP4) (MaxLight 550)

Sign In for Pricing
View Details
MGAT4A sgRNA CRISPR Lentivector (Human) (Target 1)
K1298402 1.0 µg DNA

MGAT4A sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
GLG1, CT (GLG1, CFR1, ESL1, MG160, Golgi apparatus protein 1, CFR-1, Cysteine-rich fibroblast growth factor receptor, E-selectin ligand 1, Golgi sialoglycoprotein MG-160) (Biotin) discontinued
036077-Biotin 200 µL

GLG1, CT (GLG1, CFR1, ESL1, MG160, Golgi apparatus protein 1, CFR-1, Cysteine-rich fibroblast growth factor receptor, E-selectin ligand 1, Golgi sialoglycoprotein MG-160) (Biotin) discontinued

Sign In for Pricing
View Details