Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3962 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3962 Accession Number: MIMAT0019340 Mature Sequence: AGGUAGUAGUUUGUACAUUU mmu-miR-3962 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3962 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3962 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human TRIM51 qPCR Primer Pair
QH56461S 200 Tests

Human TRIM51 qPCR Primer Pair

Sign In for Pricing
View Details
GNG2 (NM_053064) Human Tagged ORF Clone Lentiviral Particle
RC209299L1V 200 µL

GNG2 (NM_053064) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
S100A7P2 Adenovirus (Human)
42943051 1.0 mL

S100A7P2 Adenovirus (Human)

Sign In for Pricing
View Details
ARF, p14 (p16beta) (BSA & Azide Free) (PE) discontinued
A3330-04AX-PE 100 µL

ARF, p14 (p16beta) (BSA & Azide Free) (PE) discontinued

Sign In for Pricing
View Details
Jakmip1 (NM_178394) Mouse Tagged ORF Clone
MR217708 10 µg

Jakmip1 (NM_178394) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Fish HK2 (Hexokinase 2) ELISA Kit
MBS8807440-01 48 Well

Fish HK2 (Hexokinase 2) ELISA Kit

Sign In for Pricing
View Details