Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3474 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3474 Accession Number: MIMAT0015646 Mature Sequence: CCCUGGGAGGAGACGUGGAUUC mmu-miR-3474 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3474 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3474 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Trpc5 Mouse Gene Knockout Kit (CRISPR)
KN518294 1 Kit

Trpc5 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
3-Picoline
TRC-P437200-50G 50 g

3-Picoline

Sign In for Pricing
View Details
CD100 (Semaphorin-4D) (A8), CF647 conjugate, 0.1mg/mL
BNC470218-100 1x 100 µL

CD100 (Semaphorin-4D) (A8), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Frozen Tissue Sections, Lung
CS501733 5x 5 µm

Frozen Tissue Sections, Lung

Sign In for Pricing
View Details
JAK2 pTyr1007 Rabbit Polyclonal Antibody
AP02435PU-S 50 µL

JAK2 pTyr1007 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
MMP9 Antibody
KC-1699-01 50 μL

MMP9 Antibody

Sign In for Pricing
View Details