Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3472 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3472 Accession Number: MIMAT0015643 Mature Sequence: UAAUAGCCAGAAGCUGGAAGGAACC mmu-miR-3472 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3472 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3472 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

T Cell Receptor (TCR) V alpha-2 rat monoclonal antibody, clone B20.1, Purified
AM31862PU-N 200 µg

T Cell Receptor (TCR) V alpha-2 rat monoclonal antibody, clone B20.1, Purified

Sign In for Pricing
View Details
Grik2 (NM_001111268) Mouse Tagged ORF Clone
MR219234 10 µg

Grik2 (NM_001111268) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Mouse Olfr1451 (NM_146705) AAV Particle
MR213771A1V 250 µL

Mouse Olfr1451 (NM_146705) AAV Particle

Sign In for Pricing
View Details
CNOT2 Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI5A12]
TA808626AM 100 µL

CNOT2 Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI5A12]

Sign In for Pricing
View Details
CNN2 (NM_004368) Human Tagged Lenti ORF Clone
RC221104L3 10 µg

CNN2 (NM_004368) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Recombinant Escherichia coli O157:H7 Anti-adapter protein iraD (iraD)
MBS1319643-01 0.02 mg (E-Coli)

Recombinant Escherichia coli O157:H7 Anti-adapter protein iraD (iraD)

Sign In for Pricing
View Details