Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3470a miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3470a Accession Number: MIMAT0015640 Mature Sequence: UCACUUUGUAGACCAGGCUGG mmu-miR-3470a are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3470a in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3470a miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Srek1 Mouse shRNA Plasmid (Locus ID 218543)
TL514943 1 Kit

Srek1 Mouse shRNA Plasmid (Locus ID 218543)

Sign In for Pricing
View Details
FIBCD1 Protein Lysate (Mouse) with C-HA Tag
20552034 100 µg

FIBCD1 Protein Lysate (Mouse) with C-HA Tag

Sign In for Pricing
View Details
FMRP (FMR1) (NM_001185082) Human Tagged ORF Clone
RC230856 10 µg

FMRP (FMR1) (NM_001185082) Human Tagged ORF Clone

Sign In for Pricing
View Details
Chlamydia/Neisseria gonorrhoeae TaqMan Probe/Primer and Control Set
TM42510 100 Reactions

Chlamydia/Neisseria gonorrhoeae TaqMan Probe/Primer and Control Set

Sign In for Pricing
View Details
Mouse CALCOCO2 siRNA
abx910143-01 15 nmol

Mouse CALCOCO2 siRNA

Sign In for Pricing
View Details
Mouse CALCOCO2 siRNA
abx910143-02 30 nmol

Mouse CALCOCO2 siRNA

Sign In for Pricing
View Details