Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6397 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6397 Accession Number: MIMAT0025149 Mature Sequence: UGGAGACUUUCAGUGGAGUGA mmu-miR-6397 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6397 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6397 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Fut4 (NM_022219) Rat Tagged ORF Clone Lentiviral Particle
RR213948L4V 200 µL

Fut4 (NM_022219) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Rabbit anti-Escherichia coli O6:K15:H31 (strain 536/UPEC) CBPM Polyclonal Antibody
MBS7188846 Inquire

Rabbit anti-Escherichia coli O6:K15:H31 (strain 536/UPEC) CBPM Polyclonal Antibody

Sign In for Pricing
View Details
KLRC1 Protein Vector (Mouse) (pPB-N-His)
PV195035 500 ng

KLRC1 Protein Vector (Mouse) (pPB-N-His)

Sign In for Pricing
View Details
Rabbit Anti-EIF2Bδ/EIF2B4 Polyclonal Antibody
PAV6887 100 μL

Rabbit Anti-EIF2Bδ/EIF2B4 Polyclonal Antibody

Sign In for Pricing
View Details
Human SFRP3 Antibody
32528-05111 150 µg

Human SFRP3 Antibody

Sign In for Pricing
View Details
Rabbit Polyclonal USP13 Antibody [Alexa Fluor 594]
NBP1-46203AF594 0.1 mL

Rabbit Polyclonal USP13 Antibody [Alexa Fluor 594]

Sign In for Pricing
View Details