Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-21c miRNA Agomir/Antagomir

MicroRNA: mmu-miR-21c Accession Number: MIMAT0025148 Mature Sequence: UAGCUUAUCAGACUGGUACAA mmu-miR-21c are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-21c in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-21c miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cavy Inositol-Trisphosphate 3-Kinase A (ITPKA) ELISA Kit
MBS9914259 Inquire

Cavy Inositol-Trisphosphate 3-Kinase A (ITPKA) ELISA Kit

Sign In for Pricing
View Details
Rabbit Polyclonal SFTS Virus HB29 Antibody [DyLight 405]
NBP2-41156V 0.1 mL

Rabbit Polyclonal SFTS Virus HB29 Antibody [DyLight 405]

Sign In for Pricing
View Details
Anti-ASMT antibody
STJ28612 100 µl

Anti-ASMT antibody

Sign In for Pricing
View Details
Rabbit anti IgG (H&L) - TRITC
SA0509-01 100 µL

Rabbit anti IgG (H&L) - TRITC

Sign In for Pricing
View Details
Rabbit anti IgG (H&L) - TRITC
SA0509-02 1 mL

Rabbit anti IgG (H&L) - TRITC

Sign In for Pricing
View Details
MORN5 Antibody; HRP conjugated
MBS7004936-01 0.05 mg

MORN5 Antibody; HRP conjugated

Sign In for Pricing
View Details