Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-718 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-718 Accession Number: MIMAT0003514 Mature Sequence: CUUCCGCCCGGCCGGGUGUCG mmu-miR-718 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-718 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-718 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GENLISA Human Peptidoglycan (PG) ELISA
KBH14380 1x 96 Well

GENLISA Human Peptidoglycan (PG) ELISA

Sign In for Pricing
View Details
Lentiviral mouse Mcpt4 shRNA (UAS) - Lentiviral mouse Mcpt4 shRNA (UAS, GFP) plasmid
GTR15306061 1 Vial

Lentiviral mouse Mcpt4 shRNA (UAS) - Lentiviral mouse Mcpt4 shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
MAPKAPK5 (Mitogen-activated Protein Kinase-activated Protein Kinase 5, MAP Kinase-activated Protein Kinase 5, MAPK-activated Protein Kinase 5, MAPKAP Kinase 5, MAPKAPK-5, p38-regulated/activated Protein Kinase, PRAK) (MaxLight 550)
129419-ML550 100 µL

MAPKAPK5 (Mitogen-activated Protein Kinase-activated Protein Kinase 5, MAP Kinase-activated Protein Kinase 5, MAPK-activated Protein Kinase 5, MAPKAP Kinase 5, MAPKAPK-5, p38-regulated/activated Protein Kinase, PRAK) (MaxLight 550)

Sign In for Pricing
View Details
Kctd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4930202 1.0 µg DNA

Kctd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
Rabbit anti-Escherichia coli O81 (strain ED1a) FADI Polyclonal Antibody
MBS7137748 Inquire

Rabbit anti-Escherichia coli O81 (strain ED1a) FADI Polyclonal Antibody

Sign In for Pricing
View Details
Lentiviral human SCN4A shRNA (UAS) - Lentiviral human SCN4A shRNA (UAS, iRFP) plasmid
GTR15346039 1 Vial

Lentiviral human SCN4A shRNA (UAS) - Lentiviral human SCN4A shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details