Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1932 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1932 Accession Number: MIMAT0009395 Mature Sequence: GUUGCGGACAGCGCUAGGUCGG mmu-miR-1932 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1932 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1932 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ADH-6 TFA
MBS5816403 Inquire

ADH-6 TFA

Sign In for Pricing
View Details
B-Cell lymphoma/leukemia 10 (Bcl-10) Guinea Pig ELISA Kit
B8094 96 Tests

B-Cell lymphoma/leukemia 10 (Bcl-10) Guinea Pig ELISA Kit

Sign In for Pricing
View Details
Human ZNRD1 Antibody (Biotin Conjugate)
33121-05121 150 µg

Human ZNRD1 Antibody (Biotin Conjugate)

Sign In for Pricing
View Details
Rabbit Anti-MOB1A Polyclonal Antibody
PAV2337 100 μL

Rabbit Anti-MOB1A Polyclonal Antibody

Sign In for Pricing
View Details
Sirtuin 5 (SIRT5) Human ELISA Kit
H1023 96 Tests

Sirtuin 5 (SIRT5) Human ELISA Kit

Sign In for Pricing
View Details
Fish Cortisol ELISA Kit-Sandwich
EK11F355-01 48 Test

Fish Cortisol ELISA Kit-Sandwich

Sign In for Pricing
View Details