Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1932 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1932 Accession Number: MIMAT0009395 Mature Sequence: GUUGCGGACAGCGCUAGGUCGG mmu-miR-1932 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1932 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1932 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

TAS2R22 siRNA Oligos set (Human)
46184171 3x 5 nmol

TAS2R22 siRNA Oligos set (Human)

Sign In for Pricing
View Details
GD1a-Oligosaccharide
297634-01 1 mg

GD1a-Oligosaccharide

Sign In for Pricing
View Details
GD1a-Oligosaccharide
297634-02 5 mg

GD1a-Oligosaccharide

Sign In for Pricing
View Details
Gtpbp4 (NM_053689) Rat Tagged Lenti ORF Clone
RR206743L4 10 µg

Gtpbp4 (NM_053689) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
AMH Antibody / Anti-Muellerian Hormone / MIF
F52011-0.05ML 0.05 mL

AMH Antibody / Anti-Muellerian Hormone / MIF

Sign In for Pricing
View Details
FAM90A11P Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV761082 1.0 µg DNA

FAM90A11P Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

Sign In for Pricing
View Details