Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-486b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-486b-5p Accession Number: MIMAT0014943 Mature Sequence: UCCUGUACUGAGCUGCCCCGAG mmu-miR-486b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-486b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-486b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olr1472 Rat siRNA Oligo Duplex (Locus ID 405286)
SR507845 1 Kit

Olr1472 Rat siRNA Oligo Duplex (Locus ID 405286)

Sign In for Pricing
View Details
Neutrophil Gelatinase-Associated Lipocalin (NGAL), Recombinant, His-Tag discontinued
471173 1 mg

Neutrophil Gelatinase-Associated Lipocalin (NGAL), Recombinant, His-Tag discontinued

Sign In for Pricing
View Details
Kinesis Col Plug Acetal Blue
CHR5041 1 Each

Kinesis Col Plug Acetal Blue

Sign In for Pricing
View Details
pCMV-SPORT6-IL18BP Plasmid
PVT19000 2 µg

pCMV-SPORT6-IL18BP Plasmid

Sign In for Pricing
View Details
MTHFD2 (NM_006636) Human Over-expression Lysate
LH18462V 100 µg

MTHFD2 (NM_006636) Human Over-expression Lysate

Sign In for Pricing
View Details
NCSTN (Anterior pharynx defective 2, APH 2, APH2, ATAG1874, KIAA0253, NCSTN, NCT, NICA, Nicastrin, RP11 517F10.1, RP11517F101) discontinued
224421-01 50 µL

NCSTN (Anterior pharynx defective 2, APH 2, APH2, ATAG1874, KIAA0253, NCSTN, NCT, NICA, Nicastrin, RP11 517F10.1, RP11517F101) discontinued

Sign In for Pricing
View Details