Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-331-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-331-5p Accession Number: MIMAT0004643 Mature Sequence: CUAGGUAUGGUCCCAGGGAUCC mmu-miR-331-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-331-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-331-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human EDIL3 Affinity Purified Polyclonal Ab
AF6046 100 µg

Human EDIL3 Affinity Purified Polyclonal Ab

Sign In for Pricing
View Details
CHO Monoclonal Syndecan-1/CD138 Antibody (indatuximab) - Chimeric, IgG4SP - (Dry Ice)
NBP3-28673-100ug 100 µg

CHO Monoclonal Syndecan-1/CD138 Antibody (indatuximab) - Chimeric, IgG4SP - (Dry Ice)

Sign In for Pricing
View Details
XKR3 Rabbit Polyclonal Antibody
TA367385 100 µL

XKR3 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
BAHD1 Recombinant Protein (Mouse)
RP118670 100 µg

BAHD1 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
FGFBP1 3'UTR GFP Stable Cell Line
TU057937 1.0 mL

FGFBP1 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
TXNDC6, ID (NME9, TXL2, TXNDC6, Thioredoxin domain-containing protein 6, Thioredoxin-like protein 2) (PE) discontinued
043479-PE 200 µL

TXNDC6, ID (NME9, TXL2, TXNDC6, Thioredoxin domain-containing protein 6, Thioredoxin-like protein 2) (PE) discontinued

Sign In for Pricing
View Details