Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3105-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3105-5p Accession Number: MIMAT0014941 Mature Sequence: AGAGCAAGCCCGUAAGCAGCGU mmu-miR-3105-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3105-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3105-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

PPARGC1A (Peroxisome Proliferator-Activated Receptor gamma, Coactivator 1 alpha, LEM6, PGC-1(alpha), PGC-1v, PGC1, PGC1A, PPARGC1) (MaxLight 490)
MBS6208009-01 0.1 mL

PPARGC1A (Peroxisome Proliferator-Activated Receptor gamma, Coactivator 1 alpha, LEM6, PGC-1(alpha), PGC-1v, PGC1, PGC1A, PPARGC1) (MaxLight 490)

Sign In for Pricing
View Details
PPARGC1A (Peroxisome Proliferator-Activated Receptor gamma, Coactivator 1 alpha, LEM6, PGC-1(alpha), PGC-1v, PGC1, PGC1A, PPARGC1) (MaxLight 490)
MBS6208009-02 5x 0.1 mL

PPARGC1A (Peroxisome Proliferator-Activated Receptor gamma, Coactivator 1 alpha, LEM6, PGC-1(alpha), PGC-1v, PGC1, PGC1A, PPARGC1) (MaxLight 490)

Sign In for Pricing
View Details
Sodium 4-phenylbutyrate discontinued
S5150 100 mg

Sodium 4-phenylbutyrate discontinued

Sign In for Pricing
View Details
Chchd4 Mouse qPCR Primer Pair (NM_133928)
MP202785 200 Reactions

Chchd4 Mouse qPCR Primer Pair (NM_133928)

Sign In for Pricing
View Details
CSDA Protein Vector (Human) (pPM-C-His)
PV010836 500 ng

CSDA Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details
APOA4 (Apolipoprotein A-IV, Apo-AIV, ApoA-IV, Apolipoprotein A4) (MaxLight 550)
123408-ML550 100 µL

APOA4 (Apolipoprotein A-IV, Apo-AIV, ApoA-IV, Apolipoprotein A4) (MaxLight 550)

Sign In for Pricing
View Details