Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1927 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1927 Accession Number: MIMAT0009390 Mature Sequence: GACCUCUGGAUGUUAGGGACUGA mmu-miR-1927 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1927 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1927 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PHF7 (NM_016483) Human Over-expression Lysate
LC402558 20 µg

PHF7 (NM_016483) Human Over-expression Lysate

Sign In for Pricing
View Details
SYT1 Antibody
KC-323-01 50 μL

SYT1 Antibody

Sign In for Pricing
View Details
SYT1 Antibody
KC-323-02 100 µL

SYT1 Antibody

Sign In for Pricing
View Details
SYT1 Antibody
KC-323-03 1 mL

SYT1 Antibody

Sign In for Pricing
View Details
4-Nitrobenzyl 1-Thio-Beta-D-galactopryranoside
TRC-N495750-250MG 250 mg

4-Nitrobenzyl 1-Thio-Beta-D-galactopryranoside

Sign In for Pricing
View Details
S100A10 (NM_002966) Human Over-expression Lysate
LC401038 20 µg

S100A10 (NM_002966) Human Over-expression Lysate

Sign In for Pricing
View Details