Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-329-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-329-5p Accession Number: MIMAT0017032 Mature Sequence: AGAGGUUUUCUGGGUCUCUGUU mmu-miR-329-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-329-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-329-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

IKB alpha (I kappa B alpha, I (Kappa) B (alpha), I-kappa-B-alpha, IkappaBalpha, IkB-alpha, IKBA, IKBA_HUMAN, IKBalpha, MAD 3, MAD3, Major Histocompatibility Complex Enhancer Binding Protein MAD3, Major Histocompatibility Complex Enhancer-binding Protein MAD3, NF kappa B Inhibitor alpha, NF-kappa-B Inhibitor alpha, NFKBI, NFKBIA, Nuclear Factor of kappa Light Chain Gene Enhancer in B Cells, Nuclear Factor of kappa Light Polypeptide Gene Enhancer in B Cells Inhibitor alpha)
303377 100 µg

IKB alpha (I kappa B alpha, I (Kappa) B (alpha), I-kappa-B-alpha, IkappaBalpha, IkB-alpha, IKBA, IKBA_HUMAN, IKBalpha, MAD 3, MAD3, Major Histocompatibility Complex Enhancer Binding Protein MAD3, Major Histocompatibility Complex Enhancer-binding Protein MAD3, NF kappa B Inhibitor alpha, NF-kappa-B Inhibitor alpha, NFKBI, NFKBIA, Nuclear Factor of kappa Light Chain Gene Enhancer in B Cells, Nuclear Factor of kappa Light Polypeptide Gene Enhancer in B Cells Inhibitor alpha)

Sign In for Pricing
View Details
Olr1512 (NM_001001350) Rat Untagged Clone
RN201167 10 µg

Olr1512 (NM_001001350) Rat Untagged Clone

Sign In for Pricing
View Details
Mouse Monoclonal Pax5/BSAP Antibody (rPAX5/4228) [DyLight 650]
NBP3-08419C 100 µL

Mouse Monoclonal Pax5/BSAP Antibody (rPAX5/4228) [DyLight 650]

Sign In for Pricing
View Details
Recombinant Human Syntaxin 8 Protein - (Dry Ice)
H00009482-P01-10ug 10 µg

Recombinant Human Syntaxin 8 Protein - (Dry Ice)

Sign In for Pricing
View Details
Sole Allergen
51-268 1 Each

Sole Allergen

Sign In for Pricing
View Details
Htr1d sgRNA CRISPR Lentivector set (Mouse)
K3821501 3x 1.0 µg

Htr1d sgRNA CRISPR Lentivector set (Mouse)

Sign In for Pricing
View Details