Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-470-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-470-3p Accession Number: MIMAT0004760 Mature Sequence: AACCAGUACCUUUCUGAGAAGA mmu-miR-470-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-470-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-470-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ATP5S rabbit pAb
ES1730-01 50 µL

ATP5S rabbit pAb

Sign In for Pricing
View Details
ATP5S rabbit pAb
ES1730-02 100 µL

ATP5S rabbit pAb

Sign In for Pricing
View Details
Human Heat Shock Protein 27 (HSP27) Antibody
20227-05011 150 µg

Human Heat Shock Protein 27 (HSP27) Antibody

Sign In for Pricing
View Details
NOTUM, CT (NOTUM, Protein notum homolog) (MaxLight 650) discontinued
039068-ML650 100 µL

NOTUM, CT (NOTUM, Protein notum homolog) (MaxLight 650) discontinued

Sign In for Pricing
View Details
Sulfuric acid 37 % technical grade (battery acid)
LC-10379.2 1 L

Sulfuric acid 37 % technical grade (battery acid)

Sign In for Pricing
View Details
3,5-Dibromobenzoic acid methyl ester
274317-01 2 g

3,5-Dibromobenzoic acid methyl ester

Sign In for Pricing
View Details