Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6377 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6377 Accession Number: MIMAT0025122 Mature Sequence: UCAUUUGUCUUCGUGUCUGCAUC mmu-miR-6377 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6377 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6377 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

6-well Insert 2in1 PC-membrane 0.4 um multipack
F782741 24 / PCK

6-well Insert 2in1 PC-membrane 0.4 um multipack

Sign In for Pricing
View Details
N3-(4-Nitrobenzyl)uridine
MBS5826332 Inquire

N3-(4-Nitrobenzyl)uridine

Sign In for Pricing
View Details
Lentiviral human STRA8 sgRNA gene knockout kit - Lentiviral human STRA8 sgRNA gene knockout kit (25)
GTR15376983 1 Vial

Lentiviral human STRA8 sgRNA gene knockout kit - Lentiviral human STRA8 sgRNA gene knockout kit (25)

Sign In for Pricing
View Details
RGS8 AAV siRNA Pooled Vector
39487161 1.0 µg

RGS8 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
Spata31d1d Mouse qPCR Primer Pair (NM_177711)
MP213957 200 Reactions

Spata31d1d Mouse qPCR Primer Pair (NM_177711)

Sign In for Pricing
View Details
N, N'-Dibenzoyl-L-cystine
sc-253159 5 g

N, N'-Dibenzoyl-L-cystine

Sign In for Pricing
View Details