Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6377 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6377 Accession Number: MIMAT0025122 Mature Sequence: UCAUUUGUCUUCGUGUCUGCAUC mmu-miR-6377 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6377 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6377 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rat Monoclonal IL-20 R beta/FNDC6 Antibody (20RNTC) [Janelia Fluor 525]
NBP2-00466JF525 0.1 mL

Rat Monoclonal IL-20 R beta/FNDC6 Antibody (20RNTC) [Janelia Fluor 525]

Sign In for Pricing
View Details
CAMK2D (Calcium/Calmodulin-dependent Protein Kinase Type II Subunit delta, CaM Kinase II Subunit delta, CaMK-II Subunit delta, CAMKD) (AP) discontinued
124290-AP 100 µL

CAMK2D (Calcium/Calmodulin-dependent Protein Kinase Type II Subunit delta, CaM Kinase II Subunit delta, CaMK-II Subunit delta, CAMKD) (AP) discontinued

Sign In for Pricing
View Details
MINPP1 3'UTR GFP Stable Cell Line
TU063369 1.0 mL

MINPP1 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Endophilin-B1 (SH3GLB1) Peptide
abx269051 100 µg

Endophilin-B1 (SH3GLB1) Peptide

Sign In for Pricing
View Details
SPANXN1 Recombinant Protein (Human)
RP099660 100 µg

SPANXN1 Recombinant Protein (Human)

Sign In for Pricing
View Details
Rabbit anti-human Interleukin-15 polyclonal Antibody, FITC
MBS1489711-01 0.05 mg

Rabbit anti-human Interleukin-15 polyclonal Antibody, FITC

Sign In for Pricing
View Details