Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1899 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1899 Accession Number: MIMAT0007869 Mature Sequence: AGCGAUGGCCGAAUCUGCUUCC mmu-miR-1899 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1899 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1899 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Bcl-2 Peptide
AF6139-BP 1 mg

Bcl-2 Peptide

Sign In for Pricing
View Details
Recombinant Anti-CD4 Antibody, Rabbit Monoclonal
MBS8111058-01 0.1 mL

Recombinant Anti-CD4 Antibody, Rabbit Monoclonal

Sign In for Pricing
View Details
Recombinant Anti-CD4 Antibody, Rabbit Monoclonal
MBS8111058-02 5x 0.1 mL

Recombinant Anti-CD4 Antibody, Rabbit Monoclonal

Sign In for Pricing
View Details
Xkrx 3'UTR Lenti-reporter-Luc Vector
50530086 1.0 µg

Xkrx 3'UTR Lenti-reporter-Luc Vector

Sign In for Pricing
View Details
Rabbit Polyclonal E2F3 Antibody [DyLight 680]
NBP2-81745FR 0.1 mL

Rabbit Polyclonal E2F3 Antibody [DyLight 680]

Sign In for Pricing
View Details
ASCL1, NT (ASCL1, ASH1, BHLHA46, HASH1, Achaete-scute homolog 1, Class A basic helix-loop-helix protein 46) (Azide free) (HRP) discontinued
032131-HRP 200 µL

ASCL1, NT (ASCL1, ASH1, BHLHA46, HASH1, Achaete-scute homolog 1, Class A basic helix-loop-helix protein 46) (Azide free) (HRP) discontinued

Sign In for Pricing
View Details