Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6363 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6363 Accession Number: MIMAT0025107 Mature Sequence: UGUAGACUGGACUGUCCUCAAA mmu-miR-6363 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6363 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6363 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Pink1, NT (Pink1, Serine/threonine-protein kinase PINK1, mitochondrial, BRPK, PTEN-induced putative kinase protein 1) (Azide free) (HRP) discontinued
040072-HRP 200 µL

Pink1, NT (Pink1, Serine/threonine-protein kinase PINK1, mitochondrial, BRPK, PTEN-induced putative kinase protein 1) (Azide free) (HRP) discontinued

Sign In for Pricing
View Details
Rnase6 (NM_206815) Rat Tagged ORF Clone
RR211575 10 µg

Rnase6 (NM_206815) Rat Tagged ORF Clone

Sign In for Pricing
View Details
TAU (pS235) Blocking Peptide
MBS822737-01 1 mg

TAU (pS235) Blocking Peptide

Sign In for Pricing
View Details
TAU (pS235) Blocking Peptide
MBS822737-02 5 mg

TAU (pS235) Blocking Peptide

Sign In for Pricing
View Details
TAU (pS235) Blocking Peptide
MBS822737-03 5x 5 mg

TAU (pS235) Blocking Peptide

Sign In for Pricing
View Details
C11orf96 3'UTR GFP Stable Cell Line
TU052786 1.0 mL

C11orf96 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details