Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6363 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6363 Accession Number: MIMAT0025107 Mature Sequence: UGUAGACUGGACUGUCCUCAAA mmu-miR-6363 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6363 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6363 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD32B (FCGR2B) (NM_001190828) Human Tagged Lenti ORF Clone
RC231148L3 10 µg

CD32B (FCGR2B) (NM_001190828) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Lentiviral human PKIA shRNA (UAS) - Lentiviral human PKIA shRNA (UAS, GFP) plasmid
GTR15291730 1 Vial

Lentiviral human PKIA shRNA (UAS) - Lentiviral human PKIA shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
pYES6-CT Plasmid
PVT11238 2 µg

pYES6-CT Plasmid

Sign In for Pricing
View Details
SKP1P2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2154106 1.0 µg DNA

SKP1P2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Goat Polyclonal Goat anti-Guinea Pig IgG Fc Secondary Antibody [DyLight 755]
NBP2-60685IR 0.5 mL

Goat Polyclonal Goat anti-Guinea Pig IgG Fc Secondary Antibody [DyLight 755]

Sign In for Pricing
View Details
NR2F2, NT (NR2F2, ARP1, TFCOUP2, COUP transcription factor 2, Apolipoprotein A-I regulatory protein 1, COUP transcription factor II, Nuclear receptor subfamily 2 group F member 2) (FITC) discontinued
039123-FITC 200 µL

NR2F2, NT (NR2F2, ARP1, TFCOUP2, COUP transcription factor 2, Apolipoprotein A-I regulatory protein 1, COUP transcription factor II, Nuclear receptor subfamily 2 group F member 2) (FITC) discontinued

Sign In for Pricing
View Details