Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-145b miRNA Agomir/Antagomir

MicroRNA: mmu-miR-145b Accession Number: MIMAT0025105 Mature Sequence: GUCCAGUUUUCCCAGGAGACU mmu-miR-145b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-145b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-145b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

IL-24, Human (HEK293, His)
HY-P77003 50 µg

IL-24, Human (HEK293, His)

Sign In for Pricing
View Details
Lentiviral human MYO1G sgRNA gene knockout kit - Lentiviral human MYO1G sgRNA gene knockout kit (25)
GTR15391023 1 Vial

Lentiviral human MYO1G sgRNA gene knockout kit - Lentiviral human MYO1G sgRNA gene knockout kit (25)

Sign In for Pricing
View Details
Brilliant Violet 421™ anti-human CD366 (Tim-3)
GT14620 100 Tests

Brilliant Violet 421™ anti-human CD366 (Tim-3)

Sign In for Pricing
View Details
RRAS2 (NM_001177314) Human Tagged ORF Clone Lentiviral Particle
RC229627L3V 200 µL

RRAS2 (NM_001177314) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
GCAP3
MBS8577635-01 0.1 mL

GCAP3

Sign In for Pricing
View Details
GCAP3
MBS8577635-02 0.1 mL (AF405L)

GCAP3

Sign In for Pricing
View Details