Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1195 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1195 Accession Number: MIMAT0005856 Mature Sequence: UGAGUUCGAGGCCAGCCUGCUCA mmu-miR-1195 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1195 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1195 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral human STX10 shRNA (UAS) - Lentiviral human STX10 shRNA (UAS, iRFP) (25)
GTR15347657 1 Vial

Lentiviral human STX10 shRNA (UAS) - Lentiviral human STX10 shRNA (UAS, iRFP) (25)

Sign In for Pricing
View Details
Fgl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7043506 1.0 µg DNA

Fgl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
RUNX1/RUNX2/RUNX3 Recombinant Antibody, APC Conjugated
bsm-63087R-APC 100 µL

RUNX1/RUNX2/RUNX3 Recombinant Antibody, APC Conjugated

Sign In for Pricing
View Details
POLR3G Polyclonal Antibody
MBS9246105-01 0.1 mL

POLR3G Polyclonal Antibody

Sign In for Pricing
View Details
POLR3G Polyclonal Antibody
MBS9246105-02 5x 0.1 mL

POLR3G Polyclonal Antibody

Sign In for Pricing
View Details
REEP1 (NM_001164732) Human Tagged Lenti ORF Clone
RC228082L4 10 µg

REEP1 (NM_001164732) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details