Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-133a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-133a-3p Accession Number: MIMAT0000145 Mature Sequence: UUUGGUCCCCUUCAACCAGCUG mmu-miR-133a-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-133a-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-133a-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Slc22a7 Rat shRNA Lentiviral Particle (Locus ID 89776)
TL711940V 500 µL Each

Slc22a7 Rat shRNA Lentiviral Particle (Locus ID 89776)

Sign In for Pricing
View Details
Rabbit Polyclonal CLPX Antibody [Alexa Fluor 488]
NBP2-97804AF488 0.1 mL

Rabbit Polyclonal CLPX Antibody [Alexa Fluor 488]

Sign In for Pricing
View Details
Rat Ly6k Pre-designed siRNA Set B
SI207934B 1 Each

Rat Ly6k Pre-designed siRNA Set B

Sign In for Pricing
View Details
HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 405) discontinued
127701-ML405 100 µL

HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 405) discontinued

Sign In for Pricing
View Details
OR6K3 3'UTR Luciferase Stable Cell Line
TU016715 1.0 mL

OR6K3 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
Lentiviral mouse Magea1 shRNA (UAS) - Lentiviral mouse Magea1 shRNA (UAS, RFP) plasmid
GTR15140581 1 Vial

Lentiviral mouse Magea1 shRNA (UAS) - Lentiviral mouse Magea1 shRNA (UAS, RFP) plasmid

Sign In for Pricing
View Details