Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6356 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6356 Accession Number: MIMAT0025099 Mature Sequence: UCCCCAGAGUCCUAACAAUGA mmu-miR-6356 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6356 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6356 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Rabbit MMP3 (Matrix Metalloproteinase 3) ELISA Kit
EK241366 96 Well

Rabbit MMP3 (Matrix Metalloproteinase 3) ELISA Kit

Ask
View Details
C17orf58 Antibody, FITC conjugated
A56171-100UG 100 µg

C17orf58 Antibody, FITC conjugated

Ask
View Details
TTC30A Rabbit Polyclonal Antibody
E28PN6788 100 µL

TTC30A Rabbit Polyclonal Antibody

Ask
View Details
Cathepsin L1 (CTSL) Antibody (Biotin)
abx271536-01 200 µL

Cathepsin L1 (CTSL) Antibody (Biotin)

Ask
View Details
Cathepsin L1 (CTSL) Antibody (Biotin)
abx271536-02 1 mL

Cathepsin L1 (CTSL) Antibody (Biotin)

Ask
View Details
Poly (ethylene glycol) (200) adipate
21509-100 100 g

Poly (ethylene glycol) (200) adipate

Ask
View Details