Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-467b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-467b-5p Accession Number: MIMAT0005448 Mature Sequence: GUAAGUGCCUGCAUGUAUAUG mmu-miR-467b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-467b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-467b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Human CCDC117 siRNA
abx900830-01 15 nmol

Human CCDC117 siRNA

Ask
View Details
Human CCDC117 siRNA
abx900830-02 30 nmol

Human CCDC117 siRNA

Ask
View Details
Human ZFR qPCR Primer Pair
QH41837S 200 Tests

Human ZFR qPCR Primer Pair

Ask
View Details
Mib1 (NM_001107405) Rat Untagged Clone
RN215008 10 µg

Mib1 (NM_001107405) Rat Untagged Clone

Ask
View Details
Frozen Tissue Sections, Endometriotic tissue
CS502541 5x 5 µm

Frozen Tissue Sections, Endometriotic tissue

Ask
View Details
Cytoglobin (Histoglobin, HGb, Stellate Cell Activation-Associated Protein, CYGB, STAP) discontinued
360080-01 50 µL

Cytoglobin (Histoglobin, HGb, Stellate Cell Activation-Associated Protein, CYGB, STAP) discontinued

Ask
View Details