Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-669a-3-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-669a-3-3p Accession Number: MIMAT0017251 Mature Sequence: ACAUAACAUACACACACAUGUAU mmu-miR-669a-3-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-669a-3-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-669a-3-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

KIAA0494 Blocking Peptide
33R-2036 100 ug

KIAA0494 Blocking Peptide

Sign In for Pricing
View Details
PLAUR Human shRNA Plasmid Kit (Locus ID 5329)
TL310377 1 Kit

PLAUR Human shRNA Plasmid Kit (Locus ID 5329)

Sign In for Pricing
View Details
Mouse Monoclonal Beta-endorphin Antibody (CLIP/1449) [Alexa Fluor 488]
NBP2-54324AF488 100 µL

Mouse Monoclonal Beta-endorphin Antibody (CLIP/1449) [Alexa Fluor 488]

Sign In for Pricing
View Details
Monoclonal DLX2 Antibody (clone 2E12), Clone: 2E12
APR11769G 0.05mg

Monoclonal DLX2 Antibody (clone 2E12), Clone: 2E12

Sign In for Pricing
View Details
Naquotinib
M11913-01 1 g

Naquotinib

Sign In for Pricing
View Details
Naquotinib
M11913-02 100 mg

Naquotinib

Sign In for Pricing
View Details