Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6942-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6942-5p Accession Number: MIMAT0027784 Mature Sequence: UAGGAGGAGGGGAACAUUUGC mmu-miR-6942-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6942-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6942-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Rabbit Monoclonal Carbonic Anhydrase VIII/CA8 Antibody (005) [Alexa Fluor 405]
NBP2-90710AF405 0.1 mL

Rabbit Monoclonal Carbonic Anhydrase VIII/CA8 Antibody (005) [Alexa Fluor 405]

Ask
View Details
MTX1 (NM_198883) Human Over-expression Lysate
LS004580-20ug 20 µg

MTX1 (NM_198883) Human Over-expression Lysate

Ask
View Details
TRIM5 alpha (TRIM5) (NM_033093) Human Tagged Lenti ORF Clone
RC213880L4 10 µg

TRIM5 alpha (TRIM5) (NM_033093) Human Tagged Lenti ORF Clone

Ask
View Details
RAD54L2 CRISPRa sgRNA lentivector (set of three targets)(Mouse)
38430124 3x 1.0µg DNA

RAD54L2 CRISPRa sgRNA lentivector (set of three targets)(Mouse)

Ask
View Details
(S)-2-(3-((5,6-Diphenylpyrazin-2-yl)(isopropyl)amino)propyl)-1,3-dioxolan-4-one
TRC-D562830-100MG 100 mg

(S)-2-(3-((5,6-Diphenylpyrazin-2-yl)(isopropyl)amino)propyl)-1,3-dioxolan-4-one

Ask
View Details
MAdCAM1 (Mucosal Addressin Cell Adhesion Molecule 1) Human ELISA Kit
E8171 96 Tests

MAdCAM1 (Mucosal Addressin Cell Adhesion Molecule 1) Human ELISA Kit

Ask
View Details